چاپ صفحه |  صفحه نخست سامانه |  نویسندگان |  اطلاعات تفضیلی |  دانلود مقاله | دانشگاه علوم پزشکی تبریز |
| نویسنده ثبت کننده مقاله | محمد مصطفی پورسیف |
| مرحله جاری مقاله | تایید نهایی |
| دانشکده/مرکز مربوطه | مرکز تحقیقات ریز فناوری دارویی |
| کد مقاله | 73986 |
| عنوان فارسی مقاله | پژوهش ایمونوانفورماتیک مقدماتی برای پیشگویی ایمونوژنیک ترین اپی توپ های خطی و ساختاری آنتی ژن 14-3-3 اکینوکوکوس گرانولوزوس |
| عنوان لاتین مقاله | Preliminary immunoinformatics research for prediction the most immunogenic linear and conformational B-cell epitopes of 14-3-3 antigen in echinococcus granulosus |
| نوع ارائه | پوستر |
| عنوان کنگره / همایش | 17th International Congress on Infectious Diseases |
| نوع کنگره / همایش | بین المللی |
| کشور محل برگزاری کنگره/ همایش | India |
| شهر محل برگزاری کنگره/ همایش | HYDERABAD |
| سال انتشار/ ارائه شمسی | 1397 |
| سال انتشار/ارائه میلادی | 2016 |
| تاریخ شمسی شروع و خاتمه کنگره/همایش | 1394/12/12 الی 1394/12/15 |
| آدرس لینک مقاله/ همایش در شبکه اینترنت | https://www.ijidonline.com/article/S1201-9712(16)30879-7/fulltext |
| آدرس علمی (Affiliation) نویسنده متقاضی | Tabriz University of Medical Sciences, Tabriz, Iran, Islamic Republic of |
| نویسنده | نفر چندم مقاله |
|---|---|
| محمد مصطفی پورسیف | دوم |
| یداله امیدی | سوم |
| ابوالفضل برزگری | هفتم |
| جابر دهقانی | هشتم |
| عنوان | متن |
|---|---|
| خلاصه مقاله | Background: Cystic Echinococcosis (CE) is one of the most important zoonosis parasite diseases which caused by the larval stage of Echinococcus granulosus (Eg). The Eg14-3-3 protein is a vaccine candidate antigen which exists in different development stages of E. granulosus. The basement of vaccine design strategies is identification the most efficacious epitopes of the antigen. This study presents linear and conformational B cell epitopes of the Eg14-3-3 antigen via computational tools. Methods & Materials: The protoscoleces (PSC) of E. granulosus was aspirated from infected lungs and livers of slaughtered sheep (Tabriz, Iran) and then DNA samples were extracted. The polymerase chain reaction (PCR) was performed using specific primers (forward: ATGTCTTCTCTCAGTAAGCGCGA and reverse: ATCGGCTTTCGGCGGTTCAG) and basing on the sequence in GenBank (Access No. AY942149). After sequencing the PCR products, our regional Eg14-3-3 sequence was utilized (the sequence of our local Eg14-3-3 shall be published soon). The linear B-cell epitopes were predicted by Bepipred Linear Epitope Prediction algorithm with threshold 0.35. The conformational B-cell epitopes were predicted using a sequence-based server named CBTOPE which uses the support vector machine (SVM) threshold -0.3, and also the three dimensional (3D) properties of the antigen such as, Relative Solvent Accessibility, Number of Transmembrane Domains and protein tertiary structure prediction. The structural details of Eg14- 3-3 which are usable in the epitope-based vaccine design evaluated via SCRATCH Protein Predictor. Results: The Best linear B-cell epitopes were selected based on their length (<9 amino acids) and score (highest), so that the high scales consist of ATEVAEGDMQTT, DTLPEESYK, EQKHDGDAK and TGDERKQASDN. Based on CBTOPE algorithm five high 17th International Congress on Infectious Diseases / International Journal of Infectious Diseases 45S (2016) 1–477 423 score sequence were found as followed; YVAEFCTGDERKQASDN, ELARKAFDDAVAELDTLPEESYKDA, SDAGDTDAAEPPKAD, YMAKLCEQCERYDEMVKA and LSVAYKNVVGAR, so that the bold and underlined amino acids are conformational predicted epitopes. Therefore using the 3D structural parameters the most prominent conformational epitopes were YVAEFCTGDERKQASDN and ELARKAFDDAVAELDTLPEESYKDA. Conclusion: Generally, in current study the many different aspects of Eg14-3-3 B-cell epitopes were analyzed so that achieved data will give crucial details of Eg14-3-3 antigen for designing the new generation of epitope-based vaccines against Echinococcus granulosus. |
| کلمات کلیدی | vaccine- epitope - immunoinformatics |
| نام فایل | تاریخ درج فایل | اندازه فایل | دانلود |
|---|---|---|---|
| PIIS1201971216308797.pdf | 1399/07/15 | 190649 | دانلود |
| 17thICID_FinalProg.pdf | 1399/07/15 | 7502775 | دانلود |
| 17thInternational Congress Infectious Disease_Poster.pdf | 1399/07/15 | 7179961 | دانلود |
